Tutorial on Biostatistics: Longitudinal Analysis of Correlated Continuous Eye Data

Objective: To describe and demonstrate methods for analyzing data subjects correlated with the size of the elongated sustainable results.


Methods: We described the effects remain, and general mixed effects models estimating equations (GEE), applied them to the data of the Complications of Age-Related Macular Degeneration Prevention Trial (CAPT) and Eye Age-Related Disease Study (AREDS). In the CAPT (N = 1052), we assessed the effects of laser eye-specific treatment on changes in visual acuity (VA). In the AREDS study, we evaluated the effect of treatment of systemic supplement among 1463 participants with AMD category 3.


Results: In the CAPT, the correlation between the eyes (0.33 to 0.53) and the longitudinal correlation (.31 to .88) varied. There is a small treatment effect on VA change (about a letter) at 24 months for all three models (p = .009 to 0.02). Better fit model with mixed effects models of fixed effects model (p <0.001). In AREDS, no significant treatment effect on all models (p> 0.55). smokers had a significantly greater decrease compared VA non-current smokers in the fixed effects models (p = 0.04) and mixed effects model with random intercept (p = 0.0003), but few are significant in mixed effects model with random intercept and slope (p = 0.08), and the GEE models (p = 0.054 to 0.07). Better fit model with fixed effect model of mixed-effects models (p <0.0001).


Conclusion: Longitudinal models using the currency as the unit of analysis can be implemented using statistical software packages available to account for both the eyes and the correlation between longitudinal. Goodness-of-fit statistic can guide the selection of the most suitable model.

Assessment of the Regulatory Dialogue Between Pharmaceutical Companies and the European Medicines Agency on the Choice of Noninferiority Margins
Assessment of the Regulatory Dialogue Between Pharmaceutical Companies and the European Medicines Agency on the Choice of Noninferiority Margins

computing-based identification and analysis of differential gene expression globally in high-grade serous ovarian carcinoma cell lines

Ovarian cancer (OVCA) is the world’s most happening gynecologic cancer, often diagnosed at a later stage and the final result in a high mortality rate. To overcome this serious health problem, it is important to understand the molecular mechanisms and equally significant to identify biomarkers suspected and targeted drug therapy for early diagnosis and treatment of OVCA. In doing so, the strategy is designed to study the most frequently diagnosed cases of OVCA called High-Grade line of serous ovarian carcinoma cells (HGSOC) with a combination of computational biology, biostatistics and cancer informatics approaches.

This study aimed to explore global gene expression profiling, and to perform global gene analysis identified Unlike Indicated (degs) of OVCA. Microarray datasets (GSE71524) consists of a tumor and cell line samples OVCA and it is used for identification degs in this study. STRING database used for Protein-Protein Interaction (PPI) degs construct network and hub genes identified by CytoHubba. In addition, the analysis of the functional enrichment of up and down-regulated degs performed by bioinformatics database called DAVID. The microRNAs (miRNAs) and transcription factors (TF) analysis is performed with the aid of biology, MAGIA and GenCOdis3, respectively.

Dact3 Antibody

24783-100ul 100ul
EUR 390.00

DACT3 siRNA

20-abx913539
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DACT3 siRNA

20-abx913540
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Dact3 Antibody

AMM05818G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dact3 . This antibody is tested and proven to work in the following applications:

DACT3 cloning plasmid

CSB-CL856898HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 546
  • Sequence: atgatccgggccttctcgttcccggtgagccctgagcggggccggctgcggggctggctggagggtagcctggccgggctctgcgagttacattggctccgggagaggcaggagtaccgcgtgcagcaggcgctgcggctggcccagcccggaatggggggcgccgaggccgagga
  • Show more
Description: A cloning plasmid for the DACT3 gene.

DACT3 Polyclonal Antibody

31494-100ul 100ul
EUR 252.00

DACT3 Polyclonal Antibody

31494-50ul 50ul
EUR 187.00

DACT3 Rabbit pAb

A8280-100ul 100 ul
EUR 308.00

DACT3 Rabbit pAb

A8280-200ul 200 ul
EUR 459.00

DACT3 Rabbit pAb

A8280-20ul 20 ul
EUR 183.00

DACT3 Rabbit pAb

A8280-50ul 50 ul
EUR 223.00

pBluescriptR-DACT3 Plasmid

PVT16978 2 ug
EUR 325.00

Anti-DACT3 antibody

STJ110579 100 µl
EUR 277.00

DACT3 Polyclonal Conjugated Antibody

C31494 100ul
EUR 397.00

Mouse DACT3 shRNA Plasmid

20-abx984196
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DACT3 shRNA Plasmid

20-abx965547
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DACT3 Recombinant Protein (Human)

RP008728 100 ug Ask for price

DACT3 Recombinant Protein (Rat)

RP197291 100 ug Ask for price

DACT3 Recombinant Protein (Mouse)

RP127793 100 ug Ask for price

Dapper Homolog 3 (DACT3) Antibody

abx029591-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Dapper Homolog 3 (DACT3) Antibody

abx029591-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Dapper Homolog 3 (DACT3) Antibody

20-abx006116
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dapper Homolog 3 (DACT3) Antibody

20-abx320460
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

DACT3 ORF Vector (Human) (pORF)

ORF002910 1.0 ug DNA
EUR 95.00

Dact3 ORF Vector (Mouse) (pORF)

ORF042599 1.0 ug DNA
EUR 506.00

Dact3 ORF Vector (Rat) (pORF)

ORF065765 1.0 ug DNA
EUR 506.00

Dact3 sgRNA CRISPR Lentivector set (Mouse)

K3231401 3 x 1.0 ug
EUR 339.00

DACT3 sgRNA CRISPR Lentivector set (Human)

K0559401 3 x 1.0 ug
EUR 339.00

Dact3 sgRNA CRISPR Lentivector set (Rat)

K6192101 3 x 1.0 ug
EUR 339.00

Mouse Dapper homolog 3, Dact3 ELISA KIT

ELI-25837m 96 Tests
EUR 865.00

Human Dapper homolog 3, DACT3 ELISA KIT

ELI-27049h 96 Tests
EUR 824.00

Dact3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3231402 1.0 ug DNA
EUR 154.00

Dact3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3231403 1.0 ug DNA
EUR 154.00

Dact3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3231404 1.0 ug DNA
EUR 154.00

DACT3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0559402 1.0 ug DNA
EUR 154.00

DACT3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0559403 1.0 ug DNA
EUR 154.00

DACT3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0559404 1.0 ug DNA
EUR 154.00

Dact3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6192102 1.0 ug DNA
EUR 154.00

Dact3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6192103 1.0 ug DNA
EUR 154.00

Dact3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6192104 1.0 ug DNA
EUR 154.00

DACT3 Protein Vector (Rat) (pPB-C-His)

PV263058 500 ng
EUR 603.00

DACT3 Protein Vector (Rat) (pPB-N-His)

PV263059 500 ng
EUR 603.00

DACT3 Protein Vector (Rat) (pPM-C-HA)

PV263060 500 ng
EUR 603.00

DACT3 Protein Vector (Rat) (pPM-C-His)

PV263061 500 ng
EUR 603.00

DACT3 Protein Vector (Mouse) (pPB-C-His)

PV170394 500 ng
EUR 603.00

DACT3 Protein Vector (Mouse) (pPB-N-His)

PV170395 500 ng
EUR 603.00

DACT3 Protein Vector (Mouse) (pPM-C-HA)

PV170396 500 ng
EUR 603.00

DACT3 Protein Vector (Mouse) (pPM-C-His)

PV170397 500 ng
EUR 603.00

DACT3 Protein Vector (Human) (pPB-C-His)

PV011637 500 ng
EUR 329.00

DACT3 Protein Vector (Human) (pPB-N-His)

PV011638 500 ng
EUR 329.00

DACT3 Protein Vector (Human) (pPM-C-HA)

PV011639 500 ng
EUR 329.00

DACT3 Protein Vector (Human) (pPM-C-His)

PV011640 500 ng
EUR 329.00

Dact3 3'UTR GFP Stable Cell Line

TU154834 1.0 ml Ask for price

DACT3 3'UTR GFP Stable Cell Line

TU055541 1.0 ml
EUR 1521.00

DACT3 3'UTR Luciferase Stable Cell Line

TU005541 1.0 ml
EUR 1521.00

Dact3 3'UTR Luciferase Stable Cell Line

TU203138 1.0 ml Ask for price

Dact3 3'UTR Luciferase Stable Cell Line

TU104834 1.0 ml Ask for price

Dact3 3'UTR GFP Stable Cell Line

TU253138 1.0 ml Ask for price

Dact3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3231405 3 x 1.0 ug
EUR 376.00

DACT3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0559405 3 x 1.0 ug
EUR 376.00

Dact3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6192105 3 x 1.0 ug
EUR 376.00

Dact3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3231406 1.0 ug DNA
EUR 167.00

Dact3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3231407 1.0 ug DNA
EUR 167.00

Dact3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3231408 1.0 ug DNA
EUR 167.00

DACT3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0559406 1.0 ug DNA
EUR 167.00

DACT3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0559407 1.0 ug DNA
EUR 167.00

DACT3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0559408 1.0 ug DNA
EUR 167.00

Dact3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6192106 1.0 ug DNA
EUR 167.00

Dact3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6192107 1.0 ug DNA
EUR 167.00

Dact3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6192108 1.0 ug DNA
EUR 167.00

As a result, the gene consists of CSF1R, TYROBP, plek, FGR, ACLY, ACACA, LAPTM5, C1 or f162, IL10RA and CD163 gene is identified as a hub. Additionally, miRNA analysis resulted in finding a zinc finger protein association with OVCA out after applying different algorithms. On the other hand, in the analysis of TF resulted in various degs enriched with NFAT, NF1 and GABP TF. In this study, it was observed that ACACA, ACLY and CSF1R degs showed a significant occurrence in the different steps, and therefore, this gene studied, to be exact. However, the results may help to find potential biomarkers with in-depth understanding of molecular mechanisms.